BLAST Results


BLASTN 2.2.28+ Reference: Stephen F. Altschul, Thomas L. Madden, Alejandro A. Schäffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Database: Boea_hygrometrica.cds; Boea_hygrometrica.fa 449,530 sequences; 1,566,937,046 total letters Query= BDNF_Human_Exon5 Length=268 Score E Sequences producing significant alignments: (Bits) Value KQ988995.1 Dorcoceras hygrometricum cultivar XS01 unplaced geno... 41.0 0.17 KV044646.1 Dorcoceras hygrometricum cultivar XS01 unplaced geno... 37.4 2.1 KV014871.1 Dorcoceras hygrometricum cultivar XS01 unplaced geno... 37.4 2.1 KQ988481.1 Dorcoceras hygrometricum cultivar XS01 unplaced geno... 37.4 2.1 KV041826.1 Dorcoceras hygrometricum cultivar XS01 unplaced geno... 35.6 7.3 KV018556.1 Dorcoceras hygrometricum cultivar XS01 unplaced geno... 35.6 7.3 KV010043.1 Dorcoceras hygrometricum cultivar XS01 unplaced geno... 35.6 7.3 KV009698.1 Dorcoceras hygrometricum cultivar XS01 unplaced geno... 35.6 7.3 KV003984.1 Dorcoceras hygrometricum cultivar XS01 unplaced geno... 35.6 7.3 KQ990319.1 Dorcoceras hygrometricum cultivar XS01 unplaced geno... 35.6 7.3 KQ988415.1 Dorcoceras hygrometricum cultivar XS01 unplaced geno... 35.6 7.3 > BDNF_Human_Exon5 on KQ988995.1 Dorcoceras hygrometricum cultivar XS01 unplaced genomic scaffold scaffold2504, whole genome shotgun sequence Length=106872 Score = 41.0 bits (44), Expect = 0.17 Identities = 28/32 (88%), Gaps = 0/32 (0%) Strand=Plus/Plus Query 4 ACCATCCTTTTCCTTACTATGGTGGGCCACAT 35 || |||||||||||| |||||| ||| ||||| Sbjct 33083 ACAATCCTTTTCCTTCCTATGGAGGGACACAT 33114 > BDNF_Human_Exon5 on KV044646.1 Dorcoceras hygrometricum cultivar XS01 unplaced genomic scaffold scaffold62429, whole genome shotgun sequence Length=1213 Score = 37.4 bits (40), Expect = 2.1 Identities = 20/20 (100%), Gaps = 0/20 (0%) Strand=Plus/Minus Query 129 GAGCAGAGGAGGAGGAGTTT 148 |||||||||||||||||||| Sbjct 554 GAGCAGAGGAGGAGGAGTTT 535 > BDNF_Human_Exon5 on KV014871.1 Dorcoceras hygrometricum cultivar XS01 unplaced genomic scaffold scaffold170, whole genome shotgun sequence Length=607322 Score = 37.4 bits (40), Expect = 2.1 Identities = 25/28 (89%), Gaps = 0/28 (0%) Strand=Plus/Plus Query 7 ATCCTTTTCCTTACTATGGTGGGCCACA 34 |||||||||||| |||||| ||| |||| Sbjct 537377 ATCCTTTTCCTTCCTATGGAGGGGCACA 537404 > BDNF_Human_Exon5 on KQ988481.1 Dorcoceras hygrometricum cultivar XS01 unplaced genomic scaffold scaffold3907, whole genome shotgun sequence Length=75663 Score = 37.4 bits (40), Expect = 2.1 Identities = 28/32 (88%), Gaps = 1/32 (3%) Strand=Plus/Plus Query 51 TTTGGGGTCAGTGGGCCCTTTG-GAGAGTTTG 81 |||| ||||||||||| ||||| |||||| || Sbjct 68212 TTTGTGGTCAGTGGGCACTTTGCGAGAGTGTG 68243 > BDNF_Human_Exon5 on KV041826.1 Dorcoceras hygrometricum cultivar XS01 unplaced genomic scaffold scaffold59690, whole genome shotgun sequence Length=1254 Score = 35.6 bits (38), Expect = 7.3 Identities = 33/41 (80%), Gaps = 1/41 (2%) Strand=Plus/Minus Query 130 AGCAGAGGAGGAGGAGTTTGTGTGACAAGGAGCGTGACATT 170 ||||| ||||| ||| ||| ||||||||||||| | ||| Sbjct 213 AGCAGTGGAGGCACAGTCTGT-TGACAAGGAGCGTTATATT 174 > BDNF_Human_Exon5 on KV018556.1 Dorcoceras hygrometricum cultivar XS01 unplaced genomic scaffold scaffold10687, whole genome shotgun sequence Length=21673 Score = 35.6 bits (38), Expect = 7.3 Identities = 24/26 (92%), Gaps = 1/26 (4%) Strand=Plus/Minus Query 129 GAGCAGAGGAGGAGGAGTTT-GTGTG 153 |||||||||||||||| ||| ||||| Sbjct 7517 GAGCAGAGGAGGAGGAATTTAGTGTG 7492 > BDNF_Human_Exon5 on KV010043.1 Dorcoceras hygrometricum cultivar XS01 unplaced genomic scaffold scaffold7130, whole genome shotgun sequence Length=38526 Score = 35.6 bits (38), Expect = 7.3 Identities = 33/41 (80%), Gaps = 1/41 (2%) Strand=Plus/Minus Query 130 AGCAGAGGAGGAGGAGTTTGTGTGACAAGGAGCGTGACATT 170 ||||| ||||| ||| ||| ||||||||||||| | ||| Sbjct 12229 AGCAGTGGAGGCACAGTCTGT-TGACAAGGAGCGTTATATT 12190 > BDNF_Human_Exon5 on KV009698.1 Dorcoceras hygrometricum cultivar XS01 unplaced genomic scaffold scaffold1998, whole genome shotgun sequence Length=309311 Score = 35.6 bits (38), Expect = 7.3 Identities = 25/29 (86%), Gaps = 0/29 (0%) Strand=Plus/Plus Query 7 ATCCTTTTCCTTACTATGGTGGGCCACAT 35 |||||||||||| ||||| ||| ||||| Sbjct 250225 ATCCTTTTCCTTCATATGGAGGGACACAT 250253 > BDNF_Human_Exon5 on KV003984.1 Dorcoceras hygrometricum cultivar XS01 unplaced genomic scaffold scaffold5322, whole genome shotgun sequence Length=142721 Score = 35.6 bits (38), Expect = 7.3 Identities = 28/34 (82%), Gaps = 0/34 (0%) Strand=Plus/Plus Query 125 AAAAGAGCAGAGGAGGAGGAGTTTGTGTGACAAG 158 |||||||||||| | ||| || |||| |||||| Sbjct 107007 AAAAGAGCAGAGCACGAGCAGAGTGTGAGACAAG 107040 > BDNF_Human_Exon5 on KQ990319.1 Dorcoceras hygrometricum cultivar XS01 unplaced genomic scaffold scaffold28155, whole genome shotgun sequence Length=5687 Score = 35.6 bits (38), Expect = 7.3 Identities = 21/22 (95%), Gaps = 0/22 (0%) Strand=Plus/Minus Query 156 AAGGAGCGTGACATTCCTTGTA 177 |||| ||||||||||||||||| Sbjct 113 AAGGGGCGTGACATTCCTTGTA 92 > BDNF_Human_Exon5 on KQ988415.1 Dorcoceras hygrometricum cultivar XS01 unplaced genomic scaffold scaffold152, whole genome shotgun sequence Length=474923 Score = 35.6 bits (38), Expect = 7.3 Identities = 21/22 (95%), Gaps = 0/22 (0%) Strand=Plus/Minus Query 67 CCTTTGGAGAGTTTGAAGAAAA 88 ||||| |||||||||||||||| Sbjct 234967 CCTTTTGAGAGTTTGAAGAAAA 234946 Lambda K H 0.634 0.408 0.912 Gapped Lambda K H 0.625 0.410 0.780 Effective search space used: 369721372748 Database: Boea_hygrometrica.cds Posted date: Jan 8, 2019 4:35 PM Number of letters in database: 45,576,339 Number of sequences in database: 47,778 Database: Boea_hygrometrica.fa Posted date: Jan 8, 2019 4:36 PM Number of letters in database: 1,521,360,707 Number of sequences in database: 401,752 Matrix: blastn matrix 2 -3 Gap Penalties: Existence: 5, Extension: 2